A new species of leech of the genus Placobdella

iform to oblong and slightly enlarged anteriad ductal medially inserted into narrowly elliotoid posterior salivary glands ductal of anterior salivary gland anastomoses with ductual of posterior salivary gland half way between the posterior salivary gland and proboscis forming common duct Esophagus extends from the base of the proboscis with one pair sac like mycetomes Seven pairs of.

File type: PDF

File size: 3,2 MB

File name: 6a34818c495d1cb4d7fcef4c8057160bde95.pdf

40
Introduction
ere are 22 recognized species of Glossiphoniid leeches in the genus
Placobdella
para
-
sitizing birds, mammals, amphibians and reptiles (Moser et al. 2014). To date, the only
species of leech reported from the American Alligator,
Alligator mississippiensis
(Dau
-
din, 1802) Cuvier, 1807 is
Placobdella multilineata
Moore, 1953.
Placobdella multi
-
lineata
is a generalist parasite of reptiles having been reported from turtles, snakes,
and alligators from throughout the southeastern United States and Mississippi River
Valley as far north as Illinois and Iowa (Klemm 1985; Moser, Richardson, McAllister,
et al. 2014). In addition, Saumure and Doody (1998) reported two specimens of
P.
multilineata
from a three-toe Amphiuma,
Amphiuma tridactylum
Cuvier, 1827 from
Louisiana. In the course of a routine parasitological survey of blood parasites of Missis
-
sippi alligators, seven specimens of a previously undescribed species of
Placobdella
were
collected and are described herein.
Materials and methods
On 9 August 2015, seven specimens of a previously undescribed species of
Placobdella
were collected from the feet and lower jaw of a single female Mississippi alligator,
approximately 1.2 m long, that was pole snared from Davis Eddy, a cypress swamp
constituting an oxbow lake of the Pascagoula River in the Pascagoula River Wildlife
Management Area, George County, Mississippi (30°54'11"N, 088°44'35"W). Six ad
-
ditional alligators examined from the same region were leech-free.
Leeches were relaxed, xed and examined as described by Moser et al. (2006). Ter
-
minology for plane shapes follows Clopton (2004). Ranges are given followed by mean
in parentheses. One specimen was mounted in Canada balsam following the tech
-
niques of Richardson and Barger (2006). Specimens were deposited in the Invertebrate
Zoology Collection of the Peabody Museum of Natural History, Yale University, New
Haven, Connecticut, USA (YPM IZ) and the Smithsonian Institution, National Mu
-
seum of Natural History, Washington, District of Columbia, USA (USNM). e fol
-
lowing specimens held in the collection of the Peabody Museum of Natural History,
Yale University, New Haven Connecticut were examined in comparison to
Placobdella
siddalli
Richardson & Moser, and caudal sucker diameter relative to body width and
length was determined:
Placobdella ali
Hughes & Siddall, 2007 (YPM IZ 047497, N
= 1; YPM IZ 058254, N = 1; and YPM IZ 058279, N = 1),
P. multilineata
(YPM IZ
083513, N = 8),
Placobdella ornata
(Verrill, 1827) Moore, 1901 (YPM IZ 048007, N
= 1; YPM IZ 058351, N = 3, YPM IZ 058360, N = 1; YPM IZ 058371, N = 1; YPM
IZ 058551, N = 1; and YPM IZ 058322, N = 2),
Placobdella papillifera
(Verrill, 1872)
Moore, 1952 (YPM IZ 043493, N = 1; YPM IZ 043494, N = 7; and YPM IZ 043557,
N = 3),
Placobdella parasitica
(Say, 1824) Moore, 1901 (YPM IZ 053088, N = 1; YPM
IZ 058096, N = 1; YPM IZ 058091, N = 1; YPM IZ 058092, N = 1; YPM IZ 058093,
N = 1; and YPM IZ 058094, N = 1), and
Placobdella rugosa
(Verrill, 1874) Moore,
41
1901 (YPM IZ 056679, N = 1; YPM IZ 056680, N = 2; YPMIZ 056681, N=1; and
YPM IZ 058081, N = 2).
Molecular analyses were conducted according to Richardson et al. (2010) as fol
-
lows: For the proteinase K treatment step, tissue samples were taken from the caudal
suckers of individual leeches and lysed overnight at 56
o
C. DNA was isolated with the
DNeasy Blood & Tissue Kit from Qiagen (Cat. No. 69504), following the protocol
given for the purication of total DNA from animal tissues (spin-column). DNA was
eluted from the spin columns with 100 µl of buer.
Polymerase Chain Reactions (PCR) were prepared using the Illustra PuRe Taq
Ready-To-Go PCR beads from GE Health Care (Cat. No. 27-9559-01). Primers were
purchased from Invitrogen and were comprised of two primers each for mitochon
-
drial cytochrome c oxidase subunit I (CO-I) as specied by Light and Siddall (1999).
Specically, the CO-I primers were LCO1490 (5’GGTCAACAAATCATAAAGA
-
TATTGG 3’) and HCO2198 (5’TAAACTTCAGGGTGACCAAAAAATCA 3’).
Final volume of PCR reactions was 25 µl with three µl of leech genomic DNA added
per reaction. DNA was amplied under the following PCR conditions: 94
o
C for ve
min.; 35 cycles of (94
o
C for 30 sec, 50
o
C for 30 sec, 72
o
C for 45 sec); 72
o
C for seven
min. Following PCR, samples were cleaned up using a QIAquick PCR purication kit
from Qiagen (Cat. No. 28104).
Puried PCR products were sequenced using the HCO2198 primer for the
cytochrome c oxidase subunit I gene by the W. M. Keck Foundation Biotechno
logy Resource Laboratory at Yale University. e DNA sequences were aligned using
Clustal W version 2 (Larkin et al. 2007) and checked manually using SeaView 4 (Gouy
et al. 2010) and then analyzed using PAUP* 4.0b10 (Swoord 2002) and compared to
other leech DNA sequences contained within Genbank. Uncorrected p distances were
calculated using PAUP*.
Results
Species description
Placobdella siddalli
Richardson & Moser, sp. n.
http://zoobank.org/9170DAD3-1657-4000-BF99-474E6DCDCB91
Figures 1–3; 5–6
Material examined.
Holotype (YPM IZ 083857) Davis Eddy, a cypress swam consti
-
tuting an oxbow lake of the Pascagoula River in the Pascagoula River Wildlife Man
-
agement Area, George County, Mississippi (30°54'11"N, 088°44'35"W).
Paratypes (YPM IZ 083875-083876, YPM IZ 090164-090165; USNM 1422202-
1422203) Davis Eddy, a cypress swam constituting an oxbow lake of the Pascagoula
River in the Pascagoula River Wildlife Management Area, George County, Mississippi
(30°54'11"N, 088°44'35"W).
42
Figure 1.
Holotype specimen of
Placobdella siddalli
Richardson & Moser, YPM IZ 083857
A
Dorsal
surface
B
Ventral surface. Scale bar: 2 mm.
Morphological description.

External morphology
: (Fig. 1) Body elliptoid; length
of preserved specimens 9.0–11.1 (9.8) mm, width at widest point (in center of body)
3.6–5.0 (4.5) mm. Dorsum base color beige with olive-green pigment spots. Dorsal
papillae arranged in ve rows (dorsomedial, two paramedial and two paralateral rows
of unpigmented, stellate papillae) with repeating patterns of papillae size as follows:
dorsomedial papillus of neural annulus large; paramedial papillae of neural annulus
small; paralateral papillae of neural annulus large. Dorsomedial papillus of annulus
posterior to neural annulus small; paramedial papillae of annulus posterior to neural
annulus large; paralaterial papillae of annulus posterior to neural annulus small. Dor
-
somedial papillus of annulus anterior to neural annulus greatly reduced (sensillus);
paramedial and paralateral papillae lacking on annulus anterior to neural annulus.
Lateral papillae much less organized, not in distinct rows. Lateral region with alter
-
nating unpigmented and modestly pigmented sections (being characterized by small
chromatophores). Anal opening located in furrow, one anteriad annulus from the cau
-
dal sucker. Beginning adjacent to the anus and commencing anteriad are two rows of
43
Figure 2.
Internal anatomy of
Placobdella siddalli
Richardson & Moser, YPM IZ 083875. Dorsal view,
anterior salivary gland (
A
), posterior salivary gland (
P
), proboscis (
Pr
). Scale bar: 1 mm.
three papillae, followed by two pairs of prominent paramedial papillae. Two pair of
near-coalesced eyespots, typical of the genus
Placobdella
, within lateral unpigmented
mask that extends posteriad into interrupted dorsal-medial pigment line that extends
posteriorly to anus. Most pronounced pigmentation of dorsal-medial pigment line
from genital region to anterior pair of prominent paramedial papillae. Caudal sucker
orbicular, diameter 2.0–2.2 (2.1) mm; 18.64–22.9 (21.1) % of the length leech; dorsal
surface with approximately three rows of papillae, the anterior-most of which is most
prominent. Ventral surface of the whole body with scattered chromatophores, most
concentrated in genital region and without stripes.
Internal morphology:
(Figs 2 and 3) Proboscis pore on rim/lip of anterior sucker.
Blunt-tipped muscular proboscis nearly uniformly cylindrical, only very modest en
-
largement at base. Two pair of discrete salivary glands. Anterior pair very narrowly dol
-
iform to oblong and slightly enlarged anteriad; ductal medially inserted into narrowly
elliotoid posterior salivary glands; ductal of anterior salivary gland anastomoses with
ductual of posterior salivary gland half-way between the posterior salivary gland and
proboscis forming common duct. Esophagus extends from the base of the proboscis
with one pair sac-like mycetomes. Seven pairs of diverticulated crop ceca, last pair ex
-
tending posteriorly and diverticulated into four sections. Four pairs of intestinal ceca.
44
Figure 3.
Paratype specimen of
Placobdella siddalli
Richardson & Moser, YPM IZ 083876 mounted in
Canada balsam, crop ceca (
CC
), anterior salivary gland (
A
), posterior salivary gland (
P
), proboscis (
Pr
).
Scale bar: 2 mm.
Reproductive system:
Male and female gonopores in furrows and separated by two
annuli. Six pair of testisacs.
Taxonomic summary.
Type host. American Alligator,
Alligator mississippiensis
(Daudin, 1802) Cuvier, 1807
Type locality.
Davis Eddy, a cypress swamp constituting an oxbow lake of the
Pascagoula River in the Pascagoula River Wildlife Management Area, George County,
Mississippi (30°54'11"N, 088°44'35"W).
Type material.
YPM IZ 083857 (Holotype), YPM IZ 083875-083876, YPM IZ
090164-090165 (Paratypes), USNM 1422202–1422203 (Paratypes).
Etymology.
e specic epithet
siddalli
is in honor of Dr. Mark Siddall in recog
-
nition of the profound advancements that he has contributed to our understanding of
glossiphoniid leeches, particularly in regard to the taxonomic importance of preanal
papillae.
Molecular description.
Molecular characterization is based on sequence of
626 nucleotides of the mitochondrial Cytochrome c oxidase subunit I (GenBank
KY780962
). Molecular comparison of 626 nucleotides of CO-I revealed 100% iden
-
tify between two specimens of
Placobdella siddalli
Richardson & Moser collected from
the same host in Davis Eddy, George County, Mississippi (type locality; YPM IZ
083876, GenBank
KY780962
and an interspecic dierence of 14.0% to 15.7% (88
to 98 nucleotides) between
P. siddalli
Richardson & Moser and four specimens of
P.
multilineata
from Louisiana, Mississippi, and Oklahoma. Additional intraspecic dif
-
ferences of 15.9% to 16.7% (99 to 105 nucleotides) were found between
P. siddalli

Richardson & Moser and four specimens of
P. rugosa
collected from the type locality
(North Dakota; GenBank
JX412986

JX412990
); dierence of 18.0% (113 nucleo
-
tides) between
P. siddalli
Richardson & Moser and three specimens of
P. ali
from
the type locality (New York) and Connecticut (GenBank
HM347040

HM347042
);
45
Figure 4.
Dorsal surface, anal region. Medial row of small but distinct papillae (indicated by arrows)
lying between the anus and commencement of prominent paramedial papillae, on
A

Placobdella ru
-
gosa
(YPM IZ 083787)
B

Placobdella ornata
, syntype

(YPM IZ 000256)
C

Placobdella ali
(YPM IZ
058254)
D

Placobdella multilineata
(YPM IZ 083782). Scale bars: 3 mm (
A
), 1 mm (
B
), 4 mm (
C
),
2 mm (
D
).
dierences of 16.9% to 17.3% (106 to 109 nucleotides) between
P. siddalli
Richard
-
son & Moser and ve specimens of
P. papillifera
(GenBank
KC505241

KC505245
)
from its type locality (West River, New Haven, New Haven County, Connecticut);
dierences of 15.0% to 15.3% (94 to 96 nucleotides) between
P. siddalli
Richardson
& Moser and ve specimens of
P. ornata
(GenBank
JQ812128

JQ812132
) collected
from the type locality (West River, New Haven County, Connecticut); and dierences
of 14.7% and 14.8% (92 to 93 nucleotides) between
P. siddalli
Richardson & Moser
and ve specimens of
P. parasitica
collected from the type locality (Minnesota; Gen
-
Bank
KF058895

KF058899
).
Discussion
Placobdella siddalli
Richardson & Moser most closely resembles
P. multilineata
,
P. ali
,
and
P. rugosa
. Both
P. ali
and
P. rugosa
have faint but distinct brown pigmented lines
corresponding to paralateral and paramedial papillae, that are lacking in
P. siddalli

46
Figure 5.
Dorsal surface, anal region, (note lack of papillae between anus and commencement of promi
-
nent paramedial papillae) of
A

Placobdella papillifera
(YPM IZ 083792)
B

Placobdella siddalli
Richardson
& Moser (YPM IZ 083857). Scale bars: 1 mm.
Richardson & Moser. In
P. ali
, the dorso-medial line is unbroken, whereas it is broken
in
P. siddalli
Richardson & Moser. Also
P. ali
,
P. multilineata
,
P. ornata
, and
P. rugosa
,
have a medial row of small but distinct papillae, each lying between the anus and
four prominent paramedial papillae (Fig. 4). Probably because of their diminutive size,
these papillae have not previously been described although they are evident in Fig. 2 of
Moser, Richardson, Hammond, and Lazo-Wasem (2012) and Fig. 3 of Moser, Rich
-
ardson, Hammond, Govedich, and Lazo-Wasem (2012). ese papillae are lacking in
P. siddalli
Richardson & Moser and
P. papillifera
(Fig. 5).
Placobdella ali
also exhibits
ventral striping that is lacking in
P. siddalli
Richardson & Moser.
e relative diameter of the caudal sucker in comparison to body width and
body length was found to be helpful in dierentiating species of the genus
Pla
-
cobdella
(Fig.6). Table 1 gives relative size of the caudal suckers in comparison to
body width and length for
P. ali
,
P. siddalli
Richardson & Moser,
P. multilineata
,
P. ornata
,
P. papillifera
,
P. parasitica
, and
P. rugosa
. e caudal sucker diameter of
P. siddalli
Richardson & Moser is 18% to 23% of the length of the body. is rela
-
tive diameter is similar to that of
P. rugosa
and
P. papillifera
, but is greater than that
of
P. ali
and
P. multilineata
, with the caudal sucker diameter to body-length ratio
not overlapping. Likewise the diameter to body-length ratio of the caudal sucker
of
P. siddalli
Richardson & Moser is larger than that of
P. ornata
and
P. parasitica
,
overlapping only slightly. e caudal sucker diameter of
P. siddalli
Richardson &
Moser is 40% to 54% of the width of the body. is relative diameter is greater than
that of
P. ali
and
P. ornata
, with the caudal sucker diameter to body-width ratio not
overlapping.
e unique color patterning, papillation and large relative size of the caudal sucker
renders
P. siddalli
Richardson & Moser readily discernible from all described species in
47
Figure 6.
Ventral surface of various species of
Placobdella
. Note the diameter of the caudal sucker relative
to body length and width of individuals.
A

Placobdella ali
(YPM IZ 058279)
B

Placobdella ornata
(YPM
IZ 083847)
C

Placobdella siddalli
Richardson & Moser (YPM IZ 083857)
D

Placobdella multilineata
(YPM IZ 083850)
E

Placobdella papillifera
(YPM IZ 083856)
F

Placobdella parasitica
(YPM IZ 059092)
G

Placobdella rugosa
(YPM IZ 056680). Scale bars: 10 mm (
A, F
), 2 mm (
B
), 3 mm (
C
), 5 mm (
D, G
),
1 mm (
E
).
the genus
Placobdella
. It is likely that further collection, and retrospective examination
of museum holdings, of the papillated
Placobdella
will provide additional information
on the distribution and host utilization patterns of this intriguing new species.
48
In the course of this study, two new taxonomic characters have been utilized for
dierentiation of species within the genus
Placobdella
: the presence or absence of a
medial row of small but distinct papillae lying between the anus and 4 prominent
paramedial papillae and the ratio of sucker diameter to body length and width. ese
characters may help provide resolution between other species in the genus
Placobdella
,
as well as species representing other genera.
References
Clopton RE (2004) Standard nomenclature and metrics of plane shapes for use in gregarine
taxonomy. Comparative Parasitology 71(2): 130–140.
https://doi.org/10.1654/4151
Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: a multiplatform graphical user
interface for sequence alignment and phylogenetic tree building. Molecular Biology and
Evolution 27: 221–224.
https://doi.org/10.1093/molbev/msp259
Klemm DJ (1985) Freshwater leeches (Annelida: Hirudinea). In: Klemm DJ (Ed.) A Guide to
the Freshwater Annelida (Polychaeta, Naidid and Tubicid Oligochaeta, and Hirudinea)
of North America. Kendall/Hunt Publishing Co., Dubuque, 198 pp.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valen
-
tin F, Wallace IM, Wilm A, Lopez R, ompson JD, Gibson TJ, Higgins DG (2007)
CLUSTAL W and CLUSTAL X version 2.0. Bioinformatics 23: 2947–2948.
https://doi.
org/10.1093/bioinformatics/btm404
Light JE, Siddall ME (1999) Phylogeny of the leech family Glossiphoniidae based on mito
-
chondrial gene sequences and morphological data. Journal of Parasitology 85(5): 815–823.
https://doi.org/10.2307/3285816
Moser WE, Klemm DJ, Richardson DJ, Wheeler BA, Trauth SE, Daniels BA (2006) Leeches
(Annelida: Hirudinida) of northern Arkansas. Journal of the Arkansas Academy of Science
60: 84–95.
Moser WE, Richardson DJ, Hammond CI, Govedich FR, Lazo-Wasem EA (2012) Resur
-
rection and redescription of
Placobdella rugosa
(Verrill, 1874) (Hirudinida: Glossipho
-
Table 1.
Ratio of diameter of caudal sucker to body length and width for seven species in the genus
Placobdella
.
Species
Caudal sucker diameter/
Bodylength
Caudal sucker diameter/
Maximum body width
P. ali
0.12–0.17
0.27–0.33
P. siddalli
0.18–0.23
0.40–0.54
P. multilineata
0.11–0.15
0.32–0.47
P. ornata
0.13–0.19
0.23–0.38
P. papillifera
0.12–0.24
0.27–0.44
P. parasitica
0.11–0.19
0.32–0.49
P. rugosa
0.07–0.24
0.31–0.47
49
niidae). Bulletin of the Peabody Museum of Natural History. 53: 375–381.
https://doi.
org/10.3374/014.053.0203
Moser WE, Richardson DJ, Hammond CI, Lazo-Wasem EA (2012) Redescription of
Placob
-
della ornata
(Verrill, 1872) (Hirudinida: Glossiphoniidae). Bulletin of the Peabody Mu
-
seum of Natural History. 53: 325–330.
https://doi.org/10.3374/014.053.0103
Moser WE, Richardson DJ, McAllister CT, Briggler JT, Hammond CI, Trauth SE (2014)
New host and distribution records of the leech
Placobdella multilineata
Moore, 1953 (Hir
-
udinida: Glossiphoniidae). Journal of the Arkansas Academy of Science 68: 163–166.
Moser WE, Bowerman Hovingh JP, Pearl CA, Oceguera-Figueroa A (2014) New host and
distribution records of the leech
Placobdella sophieae
Oceguera-Figueroa et al. 2010
(Hirudinida: Glossiphoniidae). Comparative Parasitology 81(2): 199–202.
https://doi.
org/10.1654/4678.1
Richardson DJ, Barger MA (2006) Redescription of
Oligacanthorhynchus major
(Machado-
Filho, 1963) Schmidt, 1972 (Acanthocephala: Oligacanthorhynchidae) from the white-
lipped peccary (
Tayassu pecari
) in Bolivia. Comparative Parasitology 73(2): 157–160.
https://doi.org/10.1654/4235.1
Richardson DJ, Moser WE, Hammond CI, Shevchenko AC, Lazo-Wasem E (2010) New geo
-
graphic distribution records and host specicity of
Placobdella ali
(Hirudinida: Glossipho
-
niidae). Comparative Parasitology 77(2): 202–206.
https://doi.org/10.1654/4456.1
Saumure RA, Doody JS (1998)
Amphiuma tridactylum
(three-toe amphiuma) ectoparasites.
Herpatological Review 29(3): 163.
Swoord DL (2002) PAUP*: Phylogenetic analysis using parsimony (* and other methods),
version 4. Sinauer Associates, Sunderland, Massachusetts, 142 pp.
Dennis J. Richardson et al. / ZooKeys 667: 39–49 (2017)
39
A new species of leech of the genus
Placobdella

(Hirudinida, Glossiphoniidae) from the American
alligator (
Alligator mississippiensis
) in Mississippi, USA
Dennis J. Richardson
1
, William E. Moser
2
, Charlotte I. Hammond
1
,

Eric A. Lazo-Wasem
3
, Chris T. McAllister
4
, Eric E. Pulis
5
1
Department of Biological Sciences, Quinnipiac University, 275 Mt. Carmel Avenue, Hamden, Connecticut,
06518 USA
2
Smithsonian Institution, National Museum of Natural History, Department of Invertebrate
3
Division of Invertebrate Zoology, Peabody Museum of Natural History, Yale University, P.O. Box 208118,
New Haven, Connecticut, 06520 USA
4
Science and Mathematics Division, Eastern Oklahoma State
University, 2805 NE Lincoln Road, Idabel, Oklahoma, 74745 USA
5
Institute for Marine Mammal Studies,
10801 Dolphin Lane, Gulfport, Mississippi, 39503 USA
Corresponding author:

Dennis J. Richardson
(
[email protected]
)
Academic editor:

S. James
|Received 29 September 2016|Accepted 6 March 2017|Published 10 April 2017
http://zoobank.org/04E2A918-00A1-4E76-A302-67918C90D673
Citation:
Richardson DJ, Moser WE, Hammond CI, Lazo-Wasem EA, McAllister CT, Pulis EE (2017) A new species
of leech of the genus
Placobdella
(Hirudinida, Glossiphoniidae) from the American alligator (
Alligator mississippiensis
)
in Mississippi, USA. ZooKeys 667: 39–49.
Abstract
To date, the only species of leech reported from the American Alligator,
Alligator mississippiensis
is
Placob
-
della multilineata
. Seven specimens of a previously undescribed species of
Placobdella
were collected from
the feet and lower jaw of a single female alligator from the Pascagoula River Wildlife Management Area,
George County, Mississippi. e new species was named
Placobdella siddalli
Richardson & Moser,
sp. n.
,
in honor of the contributions of Dr. Mark Siddall to our understanding of the biology of leeches.
Placob
-
della siddalli
Richardson & Moser is similar to other papillated members of the genus
Placobdella
, but dif
-
fers from
Placobdella ali
Hughes & Siddall, 2007,

Placobdella rugosa
(Verrill, 1874),
Placobdella multiline
-
Moore, 1953, and
Placobdella papillifera
(Verrill, 1872) in coloration, papillation, ventral striping, and
in the possession of a relatively large caudal sucker. In addition, molecular comparison of 626 nucleotides
of CO-I between the new species and other papillated leeches (
P. ali
,
P. multilineata
,
Placobdella ornata
,
P.
papillifera
,
P. rugosa
) revealed interspecic dierences of 14.0–18.0% (88–113 nucleotides).
Keywords
Placobdella siddalli
,
Alligator mississippiensis
, American Alligator, Glossiphoniidae, Hirudinea, Clitellata
ZooKeys 667: 39–49 (2017)
doi:
10.3897/zookeys.667.10680
http://zookeys.pensoft.net
Copyright
Dennis J. Richardson et al.
This is an open access article distributed under the terms of the
Creative Commons Attribution License (CC
BY 4.0)
which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
RESEARCH ARTICLE
New species of
Placobdella
from the American Alligator
Launched to accelerate biodiversity research
A peer-reviewed open-access journal

Related Article

  • Stitch It for Fall Seasonal Sewing Projects to Craft Quilt
    Read more
  • Blefaroplastia - SECOM
    Read more
  • GBCD-100A GBCD-250 GBI - mitutoyo co jp
    Read more
  • Die ordnungsgem e Kirrung Rechtliche Vorgaben und Vollzug
    Read more
  • ABSCHNITT 1 Bezeichnung des Stoffs beziehungsweise des
    Read more
  • actually occurred in the eternal decree of God to justify
    Read more
  • KOMMUNEN VARUM RKET - kreafon se
    Read more
  • Mission and Vision Statements Examples
    Read more
  • V vademecum testo completo - Consap Palazzo Chigi
    Read more
  • National Hospital Inpatient Quality Reporting Measures
    Read more
  • Correction des accords des verbes - CCDMD
    Read more
  • Five Senses Mindfulness Exercise - Clayton State University
    Read more
  • Zwickts mi Wolfgang Ambros - eduhi at
    Read more
  • Anmeldeformular zum Fischerkurs gem der N
    Read more
  • New and Notable - thphys uni-heidelberg de
    Read more
  • Cytoreductive Surgery CRS and Hyperthermic
    Read more
  • DIGITAL VOICING EQUALIZER -
    Read more
  • zu den Nieders chsischen Meisterschaften DSV
    Read more
  • Bauherrin Lobe GmbH Architekten Emde Schneider
    Read more
  • lingua-video com
    Read more
  • Nordea Kredit rlige bidrag p nye l n i ejerboliger og
    Read more
  • STAR FISH
    Read more
  • Design S8884 Schal mit Schlingen - de schachenmayr com
    Read more
  • Effective Error Correction in Grammar Classes A Students
    Read more
  • How to Use a Metered Dose Inhaler - PACNJ
    Read more
  • Ficha t cnica Lifan MyWay - lifan com ar
    Read more
  • Baby Online-Shop - Babysachen Artikel f r die
    Read more
  • The Basics of Permanent Magnet Motor Operations
    Read more
  • MC 1100 Bedienungsanleitung - tipes de
    Read more
  • Dalam Dekapan Ukhuwah Salim Akhukum Fillah
    Read more
  • Morphologische Theorien III Distribuierte Morphologie 2
    Read more
  • Requerimento de Invent rio - ORDEM DOS NOT RIOS
    Read more
  • STERILISATION DES MANNES - andrologie-jungwirth at
    Read more
  • www jslc co jp
    Read more
  • Inteligencia Emocional y Estrategias de - reme uji es
    Read more
  • ETAPAS DEL PROCESO DE ACREDITACI N DE CARRERAS - urp edu pe
    Read more
  • Insulating Kits - Fluid Sealing Products
    Read more
  • Jona und der Wal - solln-evangelisch de
    Read more
  • FICHE TECHNIQUE methyl thylc tone R f MEK
    Read more

© 2014-2019 ava-cdkn.co. All rights reserved